This is an animation of DNA replication by DNA polymerase and accurately shows the function of all its subunits.

Feb 21, 2014 3:47 PM

chemistrydoc

Views

3386762

Likes

11496

Dislikes

65

This is an animation of DNA replication by DNA polymerase and accurately shows the function of all its subunits.

science

informative

My lecturer showed us this video in class. Girl behind me whispered "That's disgusting!" when it came on.

12 years ago | Likes 3 Dislikes 0

I came

12 years ago | Likes 3 Dislikes 0

I had my freaking bio exam at noon today... NOON. @chemistrydoc a little sooner next time PLEASE

12 years ago | Likes 3 Dislikes 0

Leading strand is all, "Why you gotta make a fuss about everything, lagging strand?"

12 years ago | Likes 154 Dislikes 2

fukkin' lagging strands amirite?

12 years ago | Likes 16 Dislikes 0

I'm not smart enough to know what's happening here.

12 years ago | Likes 3 Dislikes 0

I JUST watched this in genetics class today!!!!!

12 years ago | Likes 3 Dislikes 0

I JUST watched this in genetics class today!!!!!

12 years ago | Likes 3 Dislikes 0

I've seen enough hentai etc.

12 years ago | Likes 3 Dislikes 0

Can we get a PhD in here?

12 years ago | Likes 3 Dislikes 0

Who knew fuzzy pompoms and pipe cleaners were the building blocks of DNA.

12 years ago | Likes 3 Dislikes 0

Beats the hell out of any post about a lot of people trying to play the same pokemon game at the same time. +1

12 years ago | Likes 19 Dislikes 0

The floating green thing reminds me of Slimer from ghostbusters. Which concludes my expertise on this subject.

12 years ago | Likes 23 Dislikes 1

lol, they spelled CGAATTACAGGATTAGCACAGGTAAGGCAATTAAGGCCCATTAATTAATTTAAAACCAGGGAAACCTAATATATTCCACCAGGATAGATGACATGACATAGACGATAGACGTGG wrong.

12 years ago | Likes 9 Dislikes 0

Pff, I do this all the time.

12 years ago | Likes 8 Dislikes 0

Obligatory "unzip your genes" joke here

12 years ago | Likes 456 Dislikes 8

Think you mean *recharges watch*

12 years ago | Likes 1 Dislikes 0

I_wish_I_were_a_helicase_so_I_could_unzip_your_jeans.pdf .... I also love me some subjunctive tense

12 years ago | Likes 31 Dislikes 0

Once in awhile, I'm relelephant!

12 years ago | Likes 14 Dislikes 0

*sigh* * unzip*

12 years ago | Likes 7 Dislikes 0

Your "gene" shorts....?

12 years ago | Likes 6 Dislikes 0

nooooooooo

12 years ago | Likes 2 Dislikes 0

my helices subunit beta is about to make a conformational change...

12 years ago | Likes 1 Dislikes 0

As a grad student working in Microbial Genetics... YUSSSSSSSSSSS.

12 years ago | Likes 8 Dislikes 0

sigh... *unzips genes*

12 years ago | Likes 6 Dislikes 0

Clever!

12 years ago | Likes 3 Dislikes 0

I'm two weeks away from taking the Praxis II for Middle School Science, OP. Thanks for a sweet animation to add to my study resources!

12 years ago | Likes 5 Dislikes 0

God bless you for teaching science. We need more great science teachers.

12 years ago | Likes 4 Dislikes 0

This made my nucleotides the big nucleotides.

12 years ago | Likes 5 Dislikes 0

Dat shit cray.

12 years ago | Likes 5 Dislikes 0

Just wait till you hear how much DNA a human has. Enough to reach to the Sun and back... 33 times.

12 years ago | Likes 1 Dislikes 0

You misspelled "Dan." Twice.

12 years ago | Likes 4 Dislikes 0

12 years ago | Likes 1 Dislikes 0

holy shit I remember learning about this in A-Level Biology, and finding it fascinating but this tops it all! Awesome!

12 years ago | Likes 4 Dislikes 0

can you link something resembeling an explanation in lamens terms please ? :D

12 years ago | Likes 4 Dislikes 0

This is pretty well written. Definitely covers the basics. http://en.wikipedia.org/wiki/DNA_replication

12 years ago | Likes 2 Dislikes 1

but have you seen a motor protein? http://imgur.com/VwZQYcE

12 years ago | Likes 60 Dislikes 0

Should have been "bitch I'm fabulous"

12 years ago | Likes 2 Dislikes 0

seriously the fucking coolest thing ever.

12 years ago | Likes 8 Dislikes 0

That's one ballin' protein.

12 years ago | Likes 8 Dislikes 1

I fucking love kinesin. Best of all the proteins.

12 years ago | Likes 4 Dislikes 0

I guess this is cool...PS you talk in your sleep.

12 years ago | Likes 3 Dislikes 0

hey, you smell.

12 years ago | Likes 2 Dislikes 0

What's even more amazing, it's not like any of this "knows" to be doing this. It's as much a machine as a robotic assembly line is.

12 years ago | Likes 96 Dislikes 3

Which proves we are more or less self replicating biocomputers

12 years ago | Likes 2 Dislikes 0

Sometimes, I try to imagine the complexity of all the happenings in a single cell and how none of the molecules "know" to do any of it.

12 years ago | Likes 33 Dislikes 0

We're taught that cells are water balloons with the odd molecule inside, but they're all jammed in there with very little water. So (1/2)

12 years ago | Likes 12 Dislikes 1

..things are just kind of banging around inside the cell until they run into something that fits. Amazing. (2/2)

12 years ago | Likes 13 Dislikes 1

It's all form fits function and it blows my mind.

12 years ago | Likes 11 Dislikes 0

Dude, we're all just a bunch of 'mindless' cells studying how cells work. How many cells does it take to attain consciousness?

12 years ago | Likes 8 Dislikes 1

Trippy to think about where exactly the robotic physics/chemistry ends, and the conscious decisions begin.

12 years ago | Likes 4 Dislikes 0

I'm not convinced the conscious decisions ever begin. :/

12 years ago | Likes 3 Dislikes 0

This is awesome, as a Biology student- thankyou OP!

12 years ago | Likes 132 Dislikes 3

I saw this exact thing about 4 months ago in biology. Took us like 5 minutes to figure out what it was when our teacher showed us.

12 years ago | Likes 2 Dislikes 0

12 years ago | Likes 19 Dislikes 1

There are dozens of us!!

12 years ago | Likes 5 Dislikes 0

I want to see one for RNA transcription

12 years ago | Likes 3 Dislikes 0

Watching an egg's membrane depolarize Ca2+ with fluorescence is cool too

12 years ago | Likes 1 Dislikes 0

http://www.youtube.com/watch?v=5MfSYnItYvg here ya go! there's one for translation as well!

12 years ago | Likes 1 Dislikes 0

LISTEN TO ME! I HAVE FOUND THE SAUCE! http://www.youtube.com/watch?&v=OjPcT1uUZiE

12 years ago | Likes 24 Dislikes 1

.

10 years ago | Likes 1 Dislikes 0

Awesome!

12 years ago | Likes 6 Dislikes 0

THANK YOU!

12 years ago | Likes 2 Dislikes 0

This is happening in every cell in your entire body. This process happens with an error every 1,000,000 or so bases. So beautiful.

12 years ago | Likes 1402 Dislikes 33

OP's name needs to be biologydoc for this post

12 years ago | Likes 2 Dislikes 0

[deleted]

[deleted]

12 years ago (deleted Feb 22, 2014 1:34 AM) | Likes 0 Dislikes 0

not even close

12 years ago | Likes 8 Dislikes 0

You're not just a great punster! This is fascinating, thank you.

12 years ago | Likes 2 Dislikes 0

All your base are belong to us.

12 years ago | Likes 2 Dislikes 0

That's just with the built-in mechanisms, our error- checking systems make it more like 1 in 1,000,000,000

12 years ago | Likes 2 Dislikes 0

Pretty amazing stuff my friend. Molecular miracles are prevalent in the molecules of life.

12 years ago | Likes 1 Dislikes 2

How much slower than this does it really happen? Or is this the correct speed?

12 years ago | Likes 2 Dislikes 0

It it the correct speed. Search Drew Berry body code on youtube for the full videos.

12 years ago | Likes 1 Dislikes 2

My gf showed me this about 4 years ago when she had to study genetics. Awesome gif!

12 years ago | Likes 2 Dislikes 0

What happens when there IS an error?

12 years ago | Likes 2 Dislikes 0

I think you forgot about nerve cells, and all the other cells stuck in G0 :)

12 years ago | Likes 3 Dislikes 0

It's also about 6 years old. Saw this in undergrad in2008

12 years ago | Likes 2 Dislikes 0

My prof used this for Chemistry class.

12 years ago | Likes 2 Dislikes 0

Is this gif the same speed as the actual process or slowed down or sped up?

12 years ago | Likes 3 Dislikes 0

wait... ARE YOU MY PROFESSOR?!

12 years ago | Likes 2 Dislikes 0

How horny are you right now?

12 years ago | Likes 2 Dislikes 0

Are you in my class? We watched this the other day in my class.

12 years ago | Likes 2 Dislikes 0

If you listen closely, you can hear OP getting off to this.

12 years ago | Likes 3 Dislikes 0

Is funny how my professor used this same animation in the class last week

12 years ago | Likes 2 Dislikes 0

Do you teach biology as well? I'm doing this currently in my HL Biology class Internation Baccalaureate

12 years ago | Likes 2 Dislikes 0

I am quite fluent in biology. Got a BA in the subject in addition to my chemistry degree.

12 years ago | Likes 1 Dislikes 2

In some cells yes, but in a lot of them this isn't happening ever again.

12 years ago | Likes 4 Dislikes 1

wait? with and error? what is this error? :o

12 years ago | Likes 2 Dislikes 0

Sometimes DNA isn't copied exactly perfectly. Every now and then the wrong base is put in, or one is left out, or an extra one is put in.

12 years ago | Likes 2 Dislikes 0

and then we become Xmen, right?

12 years ago | Likes 2 Dislikes 0

There are some pretty cool mutations out there (check out myotonic hypertrophy), but odds are if it's going to do anything it'll be cancer.

12 years ago | Likes 2 Dislikes 0

This error, is a mutation?

12 years ago | Likes 2 Dislikes 0

Only if it is not fixed by other molecular machines whose job is to locate and repair the errors.

12 years ago | Likes 1 Dislikes 1

Do you have any websites / resources that can help me with my course? :)

12 years ago | Likes 1 Dislikes 0

Just do some Google searches. There is plenty of good stuff on the web related to this topic.

12 years ago | Likes 1 Dislikes 2

I am become error.

12 years ago | Likes 2 Dislikes 0

Mine only error every 10,000,000 or so bases, so there.

12 years ago | Likes 2 Dislikes 0

Puts six sigma to shame

12 years ago | Likes 3 Dislikes 1

Fun fact: you get cancer almost once a day. Your body usually terminates those cells before they cause damage, though.

12 years ago | Likes 2 Dislikes 0

This is basically what I work on at my job (the animation). Thanks for posting!

12 years ago | Likes 11 Dislikes 0

I want your job. How do I get to do that? Seriously...that is awesome.

12 years ago | Likes 10 Dislikes 0

and that's where cancer comes from.

12 years ago | Likes 2 Dislikes 0

My bio teacher showed us this earlier in the year...it was extremely helpful in the understanding of DNA! Favorited for sure.

12 years ago | Likes 3 Dislikes 1

It's also pretty amazing that it can make 1000 nucleotides per second

12 years ago | Likes 2 Dislikes 0

Reminds me of this:

12 years ago | Likes 11 Dislikes 1

I think I'm one big error.

12 years ago | Likes 2 Dislikes 0

Been watching for an hour now. Still haven't seen this "error".

12 years ago | Likes 2 Dislikes 0

i might cry

12 years ago | Likes 2 Dislikes 0

*Allegedly. There is this book....

12 years ago | Likes 3 Dislikes 2

I show this video to my students when I teach cell division! They also have similarly great transcription and translation animations.

12 years ago | Likes 5 Dislikes 0

You know that I know about those. Beautiful done work indeed. Drew Berry is the animator.

12 years ago | Likes 3 Dislikes 0

They must get confused as we get older then.

12 years ago | Likes 2 Dislikes 0

Not in my body.

12 years ago | Likes 11 Dislikes 3

As a bio-major thanks for putting this on here :)

12 years ago | Likes 2 Dislikes 1

#TYBG

12 years ago | Likes 2 Dislikes 1

you just gave my biochemist wife a lady boner, watch it you!

12 years ago | Likes 2 Dislikes 1

Beautiful indeed, personally I've always enjoyed viral cell attachment animations..but that can be next week's lesson.

12 years ago | Likes 2 Dislikes 1

Dat Okazaki fragment....Hngggggggh..

12 years ago | Likes 37 Dislikes 0

what mean?

12 years ago | Likes 1 Dislikes 0

As a genentist +1

12 years ago | Likes 3 Dislikes 0

Do we understand the cause of the replication errors, Doc? Also, 1:1M seems very high. That's ~3k errors per full replication. Staggering.

12 years ago | Likes 3 Dislikes 0

god. duh. ass.

12 years ago | Likes 2 Dislikes 1

2/2 normal healthy dna ends up with 1x10^-9ish of errors that stay after DNA repair

12 years ago | Likes 5 Dislikes 1

the errors in replication occur because of substitution mutations where the wrong base is added and not detected by checking enzymes

12 years ago | Likes 4 Dislikes 1

the errors are fixed there are a number of processes to either fix the errors or throw out the cells. A mutation here increases cancer risk

12 years ago | Likes 6 Dislikes 1

Only if it occurs in a tumor supressing gene or something like that, most errors occur in meaningless DNA and are inconsequential

12 years ago | Likes 1 Dislikes 0

Read my comment again, that's basically what I said

12 years ago | Likes 1 Dislikes 0

well the majority of errors occur in so called 'junk DNA' and the majority of those are silent mutations which have no effect 1)

12 years ago | Likes 5 Dislikes 1

But I thought 'junk dna' was an incorrect explanation of what happens.

12 years ago | Likes 1 Dislikes 1

junk DNA is anything that doesn't code for a protein-so regulator genes, loads of remnant DNA and a lot we don't understand

12 years ago | Likes 1 Dislikes 1

It's misleading, many regulatory regions are located in the introns among other functions we've yet to discover.

12 years ago | Likes 2 Dislikes 1

Looks like making jewelry...

11 years ago | Likes 1 Dislikes 0

Can we make this a thing? Cell machinery once a week. Dynein motors next? Maybe one of my students will learn something here.

12 years ago | Likes 1 Dislikes 0

and its interesting to note that >99% of those errors are fixed, such that the total error rate is 1x10^-9 or so.

12 years ago | Likes 72 Dislikes 0

How are the errors fixed? Is there some form of checksum or something?

12 years ago | Likes 2 Dislikes 0

Yet I still miss spelling mistakes when proof reading my assignments! The mysteries of nature eh?!

12 years ago | Likes 5 Dislikes 0

Awww, I wanted to say something like that. So you get an exception! Xeroderma Pigmentosum!

12 years ago | Likes 12 Dislikes 0

Nice~ last semester I did a genetics presentation on Cockayne Syndrome, which related to XP.

12 years ago | Likes 3 Dislikes 0

Wait, if I do cocaine I get experience points? BRB.

12 years ago | Likes 1 Dislikes 0

tough disease, verytough disease.

12 years ago | Likes 7 Dislikes 0

CHEMISTRY DOC! Thanks for this, been awhile since I saw you comment on anything. I must not be looking hard enough.

12 years ago | Likes 35 Dislikes 3

Not only did he comment.. he POSTED this!

12 years ago | Likes 1 Dislikes 0

You can subscribe to my comments. Step 1) Go to my profile Step 2) Click comments Step 3) Look at them. Just busting your balls/ovaries.

12 years ago | Likes 21 Dislikes 1

Ovaries busted; will stop cyber stalking the Chemistry Doc

12 years ago | Likes 2 Dislikes 0

ovaralls

12 years ago | Likes 15 Dislikes 0

I've watched this thing for soooo long way back when I had cell biology.

12 years ago | Likes 1 Dislikes 0

414 points for a categorically wrong statement?! Erythrocytes don't even have a nucleus for crying out loud. :)

12 years ago | Likes 1 Dislikes 0

Do you go to Case, because our professor showed us this animation literally 2 weeks ago

12 years ago | Likes 1 Dislikes 0

It's evolution, baby.

12 years ago | Likes 3 Dislikes 3

Science? I know better than to trust scientists. This is a hoax.

12 years ago | Likes 3 Dislikes 4

Aaaand.... evolution!

12 years ago | Likes 2 Dislikes 2

the cancer cell

12 years ago | Likes 2 Dislikes 2

[deleted]

[deleted]

12 years ago (deleted May 7, 2018 12:18 PM) | Likes 0 Dislikes 0

I have a BA in biology and chemistry. Ph.d leaned more towards biochemistry.

12 years ago | Likes 2 Dislikes 2

Sorry... Mister Doctor Professor Patrick

12 years ago | Likes 2 Dislikes 0

Nope, definitely not happening in most cells in my body. Most cells in the adult human are stuck in G0 phase, not using DNA replication

12 years ago | Likes 410 Dislikes 4

Wrong. An adult humans entire body (with the exception of nerve cells) is replaced every 10 or less years

12 years ago | Likes 2 Dislikes 1

not 100% sure about that, but think about how slowly that happens, and how at any given time the majority of cells are not replicating (1/2)

12 years ago | Likes 1 Dislikes 0

It is true, although its also a kind of generalisation. Different parts are replaced at different speed. I think the skeleton is the 1/2

12 years ago | Likes 1 Dislikes 0

slowest (7 or 10 years. One of the two). Whereas your skin cells are replaced many many times in 10 years.

12 years ago | Likes 1 Dislikes 0

as they never will, only a small proportion of cells are those tissue stem cells that replenish our body (2/2)

12 years ago | Likes 1 Dislikes 0

Considering that you're mostly bacteria, how do you figure?

12 years ago | Likes 5 Dislikes 2

stuck in G0 phase. that said, the process in the GIF still isn't occuring in most cells in the human body, as bacteria don't use it either

12 years ago | Likes 3 Dislikes 0

I thought i was calling out a regular imgur smartass, not a smart one. You win this round.

12 years ago | Likes 3 Dislikes 1

lol thanks, I look forward to round two :-) and i def appreciate the 100% correct call out, always good to get checked

12 years ago | Likes 2 Dislikes 0

the process in the GIF is eukaryotic replication. so yes, you are correct in saying most cells in the adult body are in fact NOT (1/2)

12 years ago | Likes 4 Dislikes 0

Bacteria outnumber human cells, but they're much smaller individually. So by cell volume, humans are still mainly human.

12 years ago | Likes 3 Dislikes 0

True, but the # of instances of DNA replication (for most cells) is dependent on cell number/identity/state rather than cell volume

12 years ago | Likes 2 Dislikes 0

I was mostly replying to the "humans are mostly bacteria" thing. Which depends on whether you go by number of cells or by volume, mass etc.

12 years ago | Likes 2 Dislikes 0

aren't mitochondria constantly replicating their own DNA? i guess they use different machinery. :/

12 years ago | Likes 3 Dislikes 0

you know it and that they do :-)

12 years ago | Likes 1 Dislikes 0

not constantly... only when they need to, which is usually because the cell is splitting. But, their machinery is slightly different.

12 years ago | Likes 3 Dislikes 0

Well I wouldn't say *most* are in G0. In the CNS, yes. But the rest of your cells need to regenerate regularly (e.g. blood, skin, GI).

12 years ago | Likes 51 Dislikes 2

Blood? Most of your blood cells barely have any DNA at all. Red blood cells have no nucleus.

12 years ago | Likes 3 Dislikes 5

They do when they're immature. They eject their nucleus during maturation, becoming reticulocytes and eventually erythrocytes (RBCs).

12 years ago | Likes 3 Dislikes 0

The nucleus is shed in erythropoiesis, long before it's a red blood cell. Even immature reticulocytes are anucleate.

12 years ago | Likes 2 Dislikes 1

yup, but the majority of those cells don't regenerate via replication, rather they're replenished from tissue pluripotent cells

12 years ago | Likes 30 Dislikes 1

which proliferate, requiring lots of DNA replication.

12 years ago | Likes 14 Dislikes 0

agreed. but my statement was that it isn't taking place in most cells. the majority of cells are not tissue pluripotent cells

12 years ago | Likes 11 Dislikes 1

so skin cells regenerate from a small number of basal cells that reproduce, blood cells regenerate from bone marrow progenitor cells (2/3)

12 years ago | Likes 17 Dislikes 1

so in all of the terminally differentiated cells (most cells in your body), there actually is no DNA replication taking place (3/3)

12 years ago | Likes 16 Dislikes 1

Those progenitor cells do have to divide though, to maintain the progenitor pool. So there is some division going on.

12 years ago | Likes 4 Dislikes 0

oh absolutely. definitely some division going on. but definitely not in all or even most cells.

12 years ago | Likes 7 Dislikes 0

Your skin never really stops doing this and that's a pretty large percentage of the bodies cells.

12 years ago | Likes 6 Dislikes 1

most of your skin cells do not regenerate, rather there is a small layer at the bottom of the epidermis that is constantly dividing

12 years ago | Likes 1 Dislikes 0

Found the biologist.

12 years ago | Likes 398 Dislikes 8

Found the biology *enthusiast*

12 years ago | Likes 3 Dislikes 3

Can finding the biologist be a thing? I'm a biologist and I approve this message

12 years ago | Likes 10 Dislikes 1

@unidan I SUMMON THEE

12 years ago | Likes 2 Dislikes 0

Neat!

12 years ago | Likes 2 Dislikes 0

I didn't know this was a game of 'spot the biologist' now I feel a fool.

12 years ago | Likes 1 Dislikes 0

chemistrydoc, I'm going to have to ask you restrict yourself to your chemistry.

12 years ago | Likes 185 Dislikes 0

[deleted]

[deleted]

12 years ago (deleted Feb 1, 2021 4:49 PM) | Likes 0 Dislikes 0

Love this comic. I don't think the original has the philosophers bit, which is too bad because it is Brilliant!

12 years ago | Likes 2 Dislikes 0

12 years ago | Likes 157 Dislikes 3

Don't listen to them! BIOCHEMISTRYDOC!

12 years ago | Likes 43 Dislikes 1

OWNED

12 years ago | Likes 18 Dislikes 3

He may have owned me here...but I own Imgur the rest of the time.

12 years ago | Likes 21 Dislikes 5

THIS IS CHEMISTRY! (internet cuddle)

12 years ago | Likes 7 Dislikes 0

lol nope, med student. either way an absolutely gorgeous animation, thanks so much for posting it!

12 years ago | Likes 87 Dislikes 1

med students are the worst.

12 years ago | Likes 4 Dislikes 3

we really are. I know it won't help, but i'm sorry... :-/

12 years ago | Likes 2 Dislikes 0

close enough

12 years ago | Likes 16 Dislikes 0

Except med students and research biologists can have a *bit* of a rivalry.

12 years ago | Likes 1 Dislikes 0

The vast majority of the cells in your body are prokaryotic. Ain't never heard of no G0 phase.

12 years ago | Likes 11 Dislikes 4

someone's not showing any love for the eukaryotes (e.g. fungi) that we're all colonized with... :-p

12 years ago | Likes 1 Dislikes 0

lmao very true. there's like 10x as many prokaryotic cells. thought of mentioning it, figured it would just complicate things.

12 years ago | Likes 8 Dislikes 0

WHAT??? O.O

12 years ago | Likes 1 Dislikes 0

(which is why antibiotics can cause constipation etc)

12 years ago | Likes 1 Dislikes 0

There are about 10 bacterial cells per human cell in a healthy adult human. Most of them in the gut, helping out.

12 years ago | Likes 2 Dislikes 0

True. But those ARE NOT human cells! ergo your reasoning is faulty.

12 years ago | Likes 2 Dislikes 0

that said, the DNA replication mechanism pictured above is eukaryotic, and therefore still "not taking place in most cells in my body"

12 years ago | Likes 9 Dislikes 0

True, but theyre not "stuck in G0 phase". They mostly just lack a clearly defined cell cycle

12 years ago | Likes 3 Dislikes 0

lmao yeah that's also true. would've been so much better if i said "most Human cells". Ah well. i'll be more accurate next time :-)

12 years ago | Likes 2 Dislikes 0

DNA makes RNA makes protein!

12 years ago | Likes 3 Dislikes 1

Nope, protein makes DNA and RNA

12 years ago | Likes 3 Dislikes 0

RNA makes protein with help from protein. You've got rRNA, mRNA, and tRNA all involved.

12 years ago | Likes 1 Dislikes 1

yup, didn't contradict that statement. FTR, freaking awesome when we first found out that the ribosomal catalytic site was RNA :-)

12 years ago | Likes 1 Dislikes 0

hows about earth,wind, and fire makes protein makes dna makes rna makes protein?

12 years ago | Likes 1 Dislikes 0

nope

12 years ago | Likes 1 Dislikes 1

DNA replication occurs through the work of proteins, as does RNA transcription. protein makes DNA and RNA (1/2)

12 years ago | Likes 2 Dislikes 1

That said, DNA is the template for DNA production and RNA production, and RNA is the template for protein production (2/2)

12 years ago | Likes 2 Dislikes 1

whoa whoa francis crick called. he said relax on his use of the word "dogmatic" =D

12 years ago | Likes 2 Dislikes 1

Is the speed accurate?

12 years ago | Likes 29 Dislikes 1

Sauce: http://en.wikipedia.org/wiki/DNA_polymerase_I I'd say this animation represents the process well in that it does happen very quickly.

12 years ago | Likes 3 Dislikes 1

+1 for source, -1 for saying sauce, and -1 for using wikipedia as a source but +1 for the effort of teaching us... so you are neutral :Þ

12 years ago | Likes 2 Dislikes 3

Wikipedia is perfectly good sauce. A study published in Nature showed that they're just as accurate as Encyclopedia Britannica.

12 years ago | Likes 1 Dislikes 1

"just as" OR can "be just as"...

12 years ago | Likes 1 Dislikes 1

No, just as. It was a well-controled study.

12 years ago | Likes 1 Dislikes 0

Yes. This is a real time animation. http://www.youtube.com/watch?v=VJ3JXFdUcwk

12 years ago | Likes 27 Dislikes 0

[Body Code Intensifies]

12 years ago | Likes 1 Dislikes 0

holy 7:45

12 years ago | Likes 6 Dislikes 0

I love science, I love you Doc!

12 years ago | Likes 2 Dislikes 0

I must have spent 10 minutes rewatching from 3:00 to 3:50 over and over again. One of the most fascinating videos I've ever seen. Thank you.

12 years ago | Likes 3 Dislikes 1

Depends on the organism. Bacteria polymerase can add ~1,000 bases/second, but in eukaryotes it 10-20 bases/second.

12 years ago | Likes 15 Dislikes 0

Yes but if this was bacterial the shape of the 'strand' would be different no?

12 years ago | Likes 1 Dislikes 0

I know very little about DNA replication in bacteria, other than it's much simpler. :/

12 years ago | Likes 1 Dislikes 0

No, both bacteria and eukaryotes have DNA and RNA, made up of the same 5 bases

12 years ago | Likes 2 Dislikes 0

and btw, bacteria have totally different mechanisms of replication - including different enzymes that catalyze them.

12 years ago | Likes 1 Dislikes 0

But, most - and I mean MOST - bacteria have CYCLICAL DNA or RNA.

12 years ago | Likes 2 Dislikes 0

including extra 'plasmids' scattered around the cell, which have multiple processes of origin

12 years ago | Likes 1 Dislikes 0

This proves that God created humans, because I don't fully understand these reactions so therefore no one can ever understand them.

12 years ago | Likes 46 Dislikes 11

You just made a statement that makes more sense than any "intelligent design" spouter can manage.

12 years ago | Likes 2 Dislikes 0

"I dont understand it so it cant be understood"? You must be fun to have as a student.

12 years ago | Likes 2 Dislikes 0

I was looking for this comment. someone says this seriously everytime this is posted.

12 years ago | Likes 13 Dislikes 2

WHY DO YOU HATE AMERICA???

12 years ago | Likes 7 Dislikes 2

Ah, the maddening argument of anti-science people. How can they not see how COOL this stuff is??

12 years ago | Likes 6 Dislikes 3

The more we learn about how things work, the more they show a beauty a million times greater than some shopworn "creator" story.

12 years ago | Likes 6 Dislikes 3

The more we learn about how things work, the more they show a beauty (God's) a million times greater than some "random" sequence of events

12 years ago | Likes 7 Dislikes 3

Agree to disagree but from a creationist's view, it's just cool to see the complexity, detail, and beauty God created for things to function

12 years ago | Likes 6 Dislikes 1

This proves that if there is God, he's an engineer.

12 years ago | Likes 11 Dislikes 6

actually it would prove that anything biological is in no way similar to human made designs whatsoever

12 years ago | Likes 2 Dislikes 2

Except a ton of that beautiful DNA is damaged and non-functional, ancient retroviral trash, or otherwise not beautiful at all.

12 years ago | Likes 8 Dislikes 3

He?

12 years ago | Likes 4 Dislikes 4

^ this guy

12 years ago | Likes 3 Dislikes 1

/she/it

12 years ago | Likes 3 Dislikes 1

There's no need to swear like a common Southerner.

12 years ago | Likes 5 Dislikes 0

Damn, walked right into it.

12 years ago | Likes 3 Dislikes 0